LXL04_015971 | RubberDandelionOmics

Gene overview

LXL04_015971

Reference: OH-1004 Chr: Chr03 Coordinates: 101151653-101156467 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2856 bp · LXL04_015971|LXL04_015971|OH1004|cDNA

ATGGTGGTGAGAATTTTGGGATTGAATCGGGGAGATGAAGAGTCACCGAGGGAGATCACAGGGAACAATCTATCAAGTGATAATGGCGGGGAGAACGGATGGTTGTTTCGATTTTTGGATTCTGGTTTCTTCTGTGAGTGGATTGCGATTAGTTATCTATACAAACATGATCACCCAGGGGTTAGGGATTATCTCTGCAACCGTATGTACACTCTTCCTTTATCTGGCCTTGAAAGCTACTTGTTCCAGATTTGTTACAT...

CDS

Download CDS FASTA

2856 bp · LXL04_015971|LXL04_015971|OH1004|CDS

ATGGTGGTGAGAATTTTGGGATTGAATCGGGGAGATGAAGAGTCACCGAGGGAGATCACAGGGAACAATCTATCAAGTGATAATGGCGGGGAGAACGGATGGTTGTTTCGATTTTTGGATTCTGGTTTCTTCTGTGAGTGGATTGCGATTAGTTATCTATACAAACATGATCACCCAGGGGTTAGGGATTATCTCTGCAACCGTATGTACACTCTTCCTTTATCTGGCCTTGAAAGCTACTTGTTCCAGATTTGTTACAT...

Protein

Download Protein FASTA

951 aa · LXL04_015971|LXL04_015971|OH1004|PROTEIN

MVVRILGLNRGDEESPREITGNNLSSDNGGENGWLFRFLDSGFFCEWIAISYLYKHDHPGVRDYLCNRMYTLPLSGLESYLFQICYMLAHKPSPSLDKFVIDICSKSLKIALKVHWFLLAEVEDSDTEKIGRIQEKCQIAATLMGEWVPLIRIQNEFSINVGKNKVFKRWQSSKLRLPPLTSSRQMHKSFSFSPSSGNNLQDEGSSSSKASHDEDNMFIKLIPGRKVRDALLFRKSVDNAESEKDGFFMRLLRDSKEEDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015971`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015971

Location Chr03:101151653-101156467 (-)

Description Similar to PI4KB1: Phosphatidylinositol 4-kinase beta 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64070`	Acts on phosphatidylinositol (PtdIns) in the first committed step in the production of the second messenger inositol-1,4,5- trisphosphate.	Functional cooperativity of enzymes of phosphoinositide conversion according to synergistic effects on pectin secretion in tobacco pollen tubes.2010 · DOI: 10.1093/mp/ssq031 Arabidopsis type-III phosphatidylinositol 4-kinases β1 and β2 are upstream of the phospholipase C pathway triggered by cold exposure.2012 · DOI: 10.1093/pcp/pcs011
`At5g09350`	Acts on phosphatidylinositol (PtdIns) in the first committed step in the production of the second messenger inositol-1,4,5-trisphosphate (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015971 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006661 phosphatidylinositol biosynthetic process Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0043327 chemotaxis to cAMP Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0048015 phosphatidylinositol-mediated signaling Biological Process

GO:0048768 root hair cell tip growth Biological Process

GO:0140459 response to Gram-positive bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT5G09350

ath:AT5G64070

ddi:DDB_G0288485

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.314

Rank 1 · LXL04_015971 · OH-1004

Golgi apparatus0.282

Rank 2 · LXL04_015971 · OH-1004

Cell membrane0.270

Rank 3 · LXL04_015971 · OH-1004

Endoplasmic reticulum0.208

Rank 4 · LXL04_015971 · OH-1004

Nucleus0.152

Rank 5 · LXL04_015971 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21245.4PI4KB-PIK1_PIK48-118 aa

PF00454.34PI3_PI4_kinase685-898 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015971	`PF21245.4`	PI4KB-PIK1_PIK	48	118	8.7e-12	45.7
LXL04_015971	`PF00454.34`	PI3_PI4_kinase	685	898	3.3e-37	129.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMJ0`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase beta 1	57.710%	Swiss-Prot	strong database homology
`Q0WPX9`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase beta 2	55.217%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card