LXL04_013843 | RubberDandelionOmics

Gene overview

LXL04_013843

Reference: OH-1004 Chr: Chr03 Coordinates: 36715041-36716540 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

765 bp · LXL04_013843|LXL04_013843|OH1004|cDNA

ATGGCAATATCCAGGTTTTCACGGTCTCCTCCCTATGAAGCACCATCCAGGTCTCGGTCCAGGTCAAGGTCAAGATCCAGGTCAAGATCCTGGTCAAGGCCAAGAGGCAGGCCTGCATCAAGATCAAGATCCAGAAGCCGTGGAAGGGAAGAGGTCGTAAATCCCGGAAATACCCTTTACGTAACTGGCCTCTCTACACGTGTCACACAGGAACAGCTCGAAGAACATTTTTCAAAAGAAGGAAAGGTGGCAAACTGTTT...

CDS

Download CDS FASTA

765 bp · LXL04_013843|LXL04_013843|OH1004|CDS

ATGGCAATATCCAGGTTTTCACGGTCTCCTCCCTATGAAGCACCATCCAGGTCTCGGTCCAGGTCAAGGTCAAGATCCAGGTCAAGATCCTGGTCAAGGCCAAGAGGCAGGCCTGCATCAAGATCAAGATCCAGAAGCCGTGGAAGGGAAGAGGTCGTAAATCCCGGAAATACCCTTTACGTAACTGGCCTCTCTACACGTGTCACACAGGAACAGCTCGAAGAACATTTTTCAAAAGAAGGAAAGGTGGCAAACTGTTT...

Protein

Download Protein FASTA

254 aa · LXL04_013843|LXL04_013843|OH1004|PROTEIN

MAISRFSRSPPYEAPSRSRSRSRSRSRSRSWSRPRGRPASRSRSRSRGREEVVNPGNTLYVTGLSTRVTQEQLEEHFSKEGKVANCFLVVEPRSRVSRGFAFITMDSTEDANRCIKHLNQSVLEHRQITVERSRRKRPRTPTPGHYLGLKNTRDTGYRGDRGGGGGGGRYRGGSGREDYGYRRSPPPYRGGGGGRGYSPRRSPPPYRGGGGRERERDYSPRRSPYYGGRSRRERTRSPPYSPPYRSPERHYGRR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013843`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013843

Location Chr03:36715041-36716540 (-)

Description Similar to SR45A: Serine/arginine-rich splicing factor SR45a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07350`	Probable splicing factor involved in constitutive and/or alternative splicing events.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013843 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0048026 positive regulation of mRNA splicing, via spliceosome Biological Process

GO:0071333 cellular response to glucose stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

KEGG gene cross-reference

ath:AT1G07350

hsa:6434

mmu:20462

rno:117259

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.974

Rank 1 · LXL04_013843 · OH-1004

Cytoplasm0.160

Rank 2 · LXL04_013843 · OH-1004

Cell membrane0.014

Rank 3 · LXL04_013843 · OH-1004

Mitochondrion0.010

Rank 4 · LXL04_013843 · OH-1004

Extracellular0.008

Rank 5 · LXL04_013843 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_159-128 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013843	`PF00076.29`	RRM_1	59	128	1.8e-16	60.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TH4`	Arabidopsis thaliana	Serine/arginine-rich splicing factor SR45a	62.136%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card