LXL04_008973 | RubberDandelionOmics

Gene overview

LXL04_008973

Reference: OH-1004 Chr: Chr02 Coordinates: 114695294-114700896 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2547 bp · LXL04_008973|LXL04_008973|OH1004|cDNA

ATGGGGTTCAAGATTTTTTTTACCAATAGTAGTATCAGCAGATGCATTGTTTTTCCCAGAAAGATATTTTGGATTGAGCTATTAGTTTTCCAGATTCTTTTATTATTAGTATTTTTGGACATCTCTGAAGCAAAATACGGGGATGAAGATTTAAGGAATCAAAGAATCGAAAAGTTTGGTGAAAAAATTCAATCGCATTCATGTATTCATGACCAGATAATCGAAGAAAGGAGGAAGAGACCTGGACACAAAGTGTTTTC...

CDS

Download CDS FASTA

2547 bp · LXL04_008973|LXL04_008973|OH1004|CDS

ATGGGGTTCAAGATTTTTTTTACCAATAGTAGTATCAGCAGATGCATTGTTTTTCCCAGAAAGATATTTTGGATTGAGCTATTAGTTTTCCAGATTCTTTTATTATTAGTATTTTTGGACATCTCTGAAGCAAAATACGGGGATGAAGATTTAAGGAATCAAAGAATCGAAAAGTTTGGTGAAAAAATTCAATCGCATTCATGTATTCATGACCAGATAATCGAAGAAAGGAGGAAGAGACCTGGACACAAAGTGTTTTC...

Protein

Download Protein FASTA

848 aa · LXL04_008973|LXL04_008973|OH1004|PROTEIN

MGFKIFFTNSSISRCIVFPRKIFWIELLVFQILLLLVFLDISEAKYGDEDLRNQRIEKFGEKIQSHSCIHDQIIEERRKRPGHKVFSVTQQVYQSQSHHLHHKGRELLGTFSKSSLFPKEEKLPIRIYLNYDAVGHSADRDCRHVGDIVKAIKNKKQQQFMMFVFVLQLGEPDLGRPSCNPHNDPPIVGDCWYNCTLEDITGEDKRHRLQKALGQTAEWFERALAVERVKGNLRLSGYSACGQDGGVQLPREYVEKGVAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008973`
TK1151 ID	TkA03G301520
OH-1004 ID	LXL04_008973
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_008973`
Location	Chr02:114695294-114700896 (+)
Description	Similar to GA17800: Leishmanolysin-like peptidase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008973` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006338 chromatin remodeling Biological Process GO:0006508 proteolysis Biological Process GO:0007052 mitotic spindle organization Biological Process GO:0007076 mitotic chromosome condensation Biological Process GO:0007100 mitotic centrosome separation Biological Process GO:0007155 cell adhesion Biological Process GO:0008354 germ cell migration Biological Process GO:0019915 lipid storage Biological Process GO:0022900 electron transport chain Biological Process GO:0045842 positive regulation of mitotic metaphase/anaphase transition Biological Process GO:0051298 centrosome duplication Biological Process GO:0051301 cell division Biological Process
KEGG gene cross-reference	cel:CELE_Y43F4A.1 dme:Dmel_CG3953 dpo:4801047 mmu:239833 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.306

Rank 1 · LXL04_008973 · OH-1004

Lysosome / Vacuole0.192

Rank 2 · LXL04_008973 · OH-1004

Cytoplasm0.163

Rank 3 · LXL04_008973 · OH-1004

Endoplasmic reticulum0.146

Rank 4 · LXL04_008973 · OH-1004

Cell membrane0.127

Rank 5 · LXL04_008973 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01457.23Peptidase_M8193-617 aa

PF23106.2EGF_Teneurin624-652 aa

PF25024.1EGF_TEN626-831 aa

PF23106.2EGF_Teneurin655-684 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008973	`PF01457.23`	Peptidase_M8	193	617	1.6e-84	285.3
LXL04_008973	`PF23106.2`	EGF_Teneurin	624	652	6.1e-10	39.7
LXL04_008973	`PF25024.1`	EGF_TEN	626	831	1e-12	48.9
LXL04_008973	`PF23106.2`	EGF_Teneurin	655	684	6.1e-10	39.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card