LXL04_007334 | RubberDandelionOmics

Gene overview

LXL04_007334

Reference: OH-1004 Chr: Chr02 Coordinates: 44607553-44622763 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7587 bp · LXL04_007334|LXL04_007334|OH1004|cDNA

ATGGCGGCTCCTGCGCAATCCTATCGTTTTGGCGGTCCGGCCACCACAGCAGCTGCTGCCGGGAATATCGAAGCTCTTAACAGAGTCCTTTCCGACCTTTGTACTAGAGGCGCCCCAAAGGATGGTTCTGCTTTTGCTTTAAGAAAACATGTTGAAGAAGAAGCACGTGCTCTTAGTGGAGAAGCCTTTTCTCGTTTCATGGATCAATTATATGATCGAATCACTACTCTTCTAGAGAGCAATGATGTTGCTGACAATTT...

CDS

Download CDS FASTA

7587 bp · LXL04_007334|LXL04_007334|OH1004|CDS

ATGGCGGCTCCTGCGCAATCCTATCGTTTTGGCGGTCCGGCCACCACAGCAGCTGCTGCCGGGAATATCGAAGCTCTTAACAGAGTCCTTTCCGACCTTTGTACTAGAGGCGCCCCAAAGGATGGTTCTGCTTTTGCTTTAAGAAAACATGTTGAAGAAGAAGCACGTGCTCTTAGTGGAGAAGCCTTTTCTCGTTTCATGGATCAATTATATGATCGAATCACTACTCTTCTAGAGAGCAATGATGTTGCTGACAATTT...

Protein

Download Protein FASTA

2528 aa · LXL04_007334|LXL04_007334|OH1004|PROTEIN

MAAPAQSYRFGGPATTAAAAGNIEALNRVLSDLCTRGAPKDGSAFALRKHVEEEARALSGEAFSRFMDQLYDRITTLLESNDVADNLGALRATDELIDLRLGESGTKVSKFSNYMRIVFDTKRDPEILILASKVLGHLARAGGAMTADEVECQVKNALKWLGGERVEYRRFAAVLILKEMAENASTVFNVHVPEFVDAIWVALRDPTLAVRERAVEALRACLRVIEKRETRWRVQWYYRMFEATQDGLGKNASVHSIHGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007334`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007334

Location Chr02:44607553-44622763 (+)

Description Similar to TOR: Serine/threonine-protein kinase TOR

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50030`	Essential cell growth regulator that controls development from early embryo to seed production.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0235300`	Component of TORC1 complex, which is an essential cell growth regulator that controls plant development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007334 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0001558 regulation of cell growth Biological Process

GO:0006935 chemotaxis Biological Process

GO:0006952 defense response Biological Process

GO:0007584 response to nutrient Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009303 rRNA transcription Biological Process

GO:0009615 response to virus Biological Process

GO:0009630 gravitropism Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT1G50030

ddi:DDB_G0281569

dosa:Os05g0235300

spo:2540473

spo:2540720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.478

Rank 1 · LXL04_007334 · OH-1004

Nucleus0.316

Rank 2 · LXL04_007334 · OH-1004

Golgi apparatus0.174

Rank 3 · LXL04_007334 · OH-1004

Lysosome / Vacuole0.122

Rank 4 · LXL04_007334 · OH-1004

Cell membrane0.105

Rank 5 · LXL04_007334 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13513.13HEAT_EZ170-219 aa

PF25574.2TPR_IMB1662-804 aa

PF11865.15mTOR_dom769-937 aa

PF23271.2HEAT_GCN11005-1146 aa

PF02259.30FAT1470-1834 aa

PF23593.2HEAT_ATR1848-1928 aa

PF08771.17FRB_dom1941-2043 aa

PF00454.34PI3_PI4_kinase2140-2388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007334	`PF13513.13`	HEAT_EZ	170	219	2.4e-13	50.9
LXL04_007334	`PF25574.2`	TPR_IMB1	662	804	5.3e-10	39.3
LXL04_007334	`PF11865.15`	mTOR_dom	769	937	3.1e-57	193.7
LXL04_007334	`PF23271.2`	HEAT_GCN1	1005	1146	1.3e-13	52.1
LXL04_007334	`PF02259.30`	FAT	1470	1834	1.1e-95	321.5
LXL04_007334	`PF23593.2`	HEAT_ATR	1848	1928	4.4e-11	43.3
LXL04_007334	`PF08771.17`	FRB_dom	1941	2043	1.2e-37	128.8
LXL04_007334	`PF00454.34`	PI3_PI4_kinase	2140	2388	4.7e-81	273.0
LXL04_007334	`PF02260.26`	FATC	2498	2528	5.6e-15	55.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FR53`	Arabidopsis thaliana	Serine/threonine-protein kinase TOR	78.771%	Swiss-Prot	strong database homology
`Q0DJS1`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase TOR	75.010%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card