LXL04_004904 | RubberDandelionOmics

Gene overview

LXL04_004904

Reference: OH-1004 Chr: Chr01 Coordinates: 149940702-149944433 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2298 bp · LXL04_004904|LXL04_004904|OH1004|cDNA

ATGGGGAACCATAACTCCGGCGGGCGCCACCACCTACGAAACCGTAGAAATGGTGAACCAGTAGTCCAGAACCCTCAATATTACTACGGAACTCCATCAGATCTCCCACCACAAAACCCGGCGAGCTCAATCACGCATAACGAAATGGCAGTAGTATCACTTCCTTACTCTCAAGTCGATTGCAACTTGCGAGCTCTCGCCGGTCAAGCAGAGGGCTTCGGTCGCTTCGCCATCGGTGGACTCCATGGACCGCTCTATCA...

CDS

Download CDS FASTA

2298 bp · LXL04_004904|LXL04_004904|OH1004|CDS

ATGGGGAACCATAACTCCGGCGGGCGCCACCACCTACGAAACCGTAGAAATGGTGAACCAGTAGTCCAGAACCCTCAATATTACTACGGAACTCCATCAGATCTCCCACCACAAAACCCGGCGAGCTCAATCACGCATAACGAAATGGCAGTAGTATCACTTCCTTACTCTCAAGTCGATTGCAACTTGCGAGCTCTCGCCGGTCAAGCAGAGGGCTTCGGTCGCTTCGCCATCGGTGGACTCCATGGACCGCTCTATCA...

Protein

Download Protein FASTA

765 aa · LXL04_004904|LXL04_004904|OH1004|PROTEIN

MGNHNSGGRHHLRNRRNGEPVVQNPQYYYGTPSDLPPQNPASSITHNEMAVVSLPYSQVDCNLRALAGQAEGFGRFAIGGLHGPLYHVTTLSDDGPGSLRAGCRKKEPLWIVFEVSGTIELSSYLNVSSYKTIDGRGQMIKLTGKGLKLKECEHVIVCNLQFEGGRGHDIDGIQIKPNSKHIWIDRCTLKDYDDGLIDITRESTNITISRCHFSNHDKTMLIGADPSHHGDRCMCVTIHHCFFDGTRQRHPRVRFAKVHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004904`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004904

Location Chr01:149940702-149944433 (-)

Description Similar to At1g30350: Probable pectate lyase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30350`	Probable pectate lyase 4.	No verified direct reference in this release
`At5g55720`	Putative pectate lyase 21.	No verified direct reference in this release
`At3g54920`	Susceptibility factor required for infection by most powdery mildews, but not by unrelated pathogens.	PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis.2002 · DOI: 10.1105/tpc.003509

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004904 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0045490 pectin catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0030570 pectate lyase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G30350

ath:AT5G55720

sly:101253756

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.535

Rank 1 · LXL04_004904 · OH-1004

Extracellular0.216

Rank 2 · LXL04_004904 · OH-1004

Nucleus0.172

Rank 3 · LXL04_004904 · OH-1004

Lysosome / Vacuole0.122

Rank 4 · LXL04_004904 · OH-1004

Cell membrane0.100

Rank 5 · LXL04_004904 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00544.26Pectate_lyase_4125-308 aa

PF13229.13Beta_helix144-218 aa

PF00544.26Pectate_lyase_4513-685 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004904	`PF00544.26`	Pectate_lyase_4	125	308	1.5e-55	189.4
LXL04_004904	`PF13229.13`	Beta_helix	144	218	8.5e-10	39.2
LXL04_004904	`PF00544.26`	Pectate_lyase_4	513	685	1.5e-55	189.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8G4`	Arabidopsis thaliana	Probable pectate lyase 4	37.801%	Swiss-Prot	weak database homology
`Q9FM66`	Arabidopsis thaliana	Putative pectate lyase 21	38.732%	Swiss-Prot	weak database homology
`Q93Z04`	Arabidopsis thaliana	Probable pectate lyase 13	37.705%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card