LXL04_001274 | RubberDandelionOmics

Gene overview

LXL04_001274

Reference: OH-1004 Chr: Chr01 Coordinates: 23309115-23311362 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

963 bp · LXL04_001274|LXL04_001274|OH1004|cDNA

ATGGCGACAAGGAATAGGACATTTCTCTTTAGGAGGTATAGAGATGCATTGAAGAGCGTTAGGGTTCCGTCGGGCCGTTCTGCGGTTTCCGACGGTGGTGCGATGATCGAAATGGCTGACGCTTCCCTGCTTAAGCAAAATCGTTCTTACGCTCCTCTTAGTACACATGATCCTGGAACTTCCTCTGTGGGGACACCAATGATGGGACTTCCTCCAGCTTGGGTTGACGTATCTGAAGAAATAGCAGCAAACATTCAACG...

CDS

Download CDS FASTA

963 bp · LXL04_001274|LXL04_001274|OH1004|CDS

ATGGCGACAAGGAATAGGACATTTCTCTTTAGGAGGTATAGAGATGCATTGAAGAGCGTTAGGGTTCCGTCGGGCCGTTCTGCGGTTTCCGACGGTGGTGCGATGATCGAAATGGCTGACGCTTCCCTGCTTAAGCAAAATCGTTCTTACGCTCCTCTTAGTACACATGATCCTGGAACTTCCTCTGTGGGGACACCAATGATGGGACTTCCTCCAGCTTGGGTTGACGTATCTGAAGAAATAGCAGCAAACATTCAACG...

Protein

Download Protein FASTA

320 aa · LXL04_001274|LXL04_001274|OH1004|PROTEIN

MATRNRTFLFRRYRDALKSVRVPSGRSAVSDGGAMIEMADASLLKQNRSYAPLSTHDPGTSSVGTPMMGLPPAWVDVSEEIAANIQRARSKMSELSKAHAQALMPSFGDGREDQHRIEALTHEVTDLLKKSERSLRRLSAAGRAEDSTVRKNVQRSLATDLQSLSMELRRKQSMYLKRLQQQKEGSDGVDLEMTLNGMHSRSEDDDFDDFGFNEHQMAKLKKSEAFTMERDREIQQVAESVNELAQIMKDLSVLVIDQGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001274`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001274

Location Chr01:23309115-23311362 (-)

Description Similar to SYP43: Syntaxin-43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05710`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
`At5g26980`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22
`At4g02195`	Contributes to the regulation of secretory and vacuolar transport pathways in the post-Golgi network, and to the maintenance of the Golgi apparatus and trans-Golgi network (TGN) morphologies.	Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001274 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0007030 Golgi organization Biological Process

GO:0007034 vacuolar transport Biological Process

GO:0009306 protein secretion Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0043001 Golgi to plasma membrane protein transport Biological Process

GO:0048278 vesicle docking Biological Process

KEGG gene cross-reference

ath:AT3G05710

ath:AT4G02195

ath:AT5G26980

hsa:8675

mmu:228960

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.631

Rank 1 · LXL04_001274 · OH-1004

Cytoplasm0.254

Rank 2 · LXL04_001274 · OH-1004

Endoplasmic reticulum0.168

Rank 3 · LXL04_001274 · OH-1004

Cell membrane0.116

Rank 4 · LXL04_001274 · OH-1004

Lysosome / Vacuole0.109

Rank 5 · LXL04_001274 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14523.13Syntaxin_278-181 aa

PF05739.27SNARE228-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001274	`PF14523.13`	Syntaxin_2	78	181	8.7e-06	26.5
LXL04_001274	`PF05739.27`	SNARE	228	303	4.7e-23	81.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUJ1`	Arabidopsis thaliana	Syntaxin-43	71.471%	Swiss-Prot	strong database homology
`O65359`	Arabidopsis thaliana	Tlg2p-like protein a	69.846%	Swiss-Prot	strong database homology
`Q9SWH4`	Arabidopsis thaliana	Syntaxin-42	62.848%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card