LXL04_000481 | RubberDandelionOmics

Gene overview

LXL04_000481

Reference: OH-1004 Chr: Chr01 Coordinates: 8685328-8692506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5103 bp · LXL04_000481|LXL04_000481|OH1004|cDNA

ATGGCGAACAAGCTAATAAGCGAAATGGGACTGCCGAAATCGATTGGGCACATATTCGCTGCTCGCAATATCATTACCGCCAAGGATGCTTTATCATTGACTGAATTTGAGTTGATGGAACTGTTAGATGTGAGTCTTCCCCAAGTCACATTAGCAGTAGCTCTCATTAGTGAGATTGCTTCTCCTCCATATCAAACAGTGAGATCCATGTTGGAACATCGCATGCAAAATGAGTACCTGACAGGTCATCTTCCAACACA...

CDS

Download CDS FASTA

5103 bp · LXL04_000481|LXL04_000481|OH1004|CDS

ATGGCGAACAAGCTAATAAGCGAAATGGGACTGCCGAAATCGATTGGGCACATATTCGCTGCTCGCAATATCATTACCGCCAAGGATGCTTTATCATTGACTGAATTTGAGTTGATGGAACTGTTAGATGTGAGTCTTCCCCAAGTCACATTAGCAGTAGCTCTCATTAGTGAGATTGCTTCTCCTCCATATCAAACAGTGAGATCCATGTTGGAACATCGCATGCAAAATGAGTACCTGACAGGTCATCTTCCAACACA...

Protein

Download Protein FASTA

1700 aa · LXL04_000481|LXL04_000481|OH1004|PROTEIN

MANKLISEMGLPKSIGHIFAARNIITAKDALSLTEFELMELLDVSLPQVTLAVALISEIASPPYQTVRSMLEHRMQNEYLTGHLPTHLKGLDAALCGGIPFGGLTELVGPAGIGKTQFCLKIALLATLPSCYGGLDGHVIYIDVESKFSSRRLIEIGINSFPDIFRLDGMAKEMAGRITVLRPGSLSEFTESLQKIKVSLIQHQVKLLVVDSMAALVSGSLAEFSRIPVVMTNQVRSRSATEISQYSFQDNRADATTDDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000481`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000481

Location Chr01:8685328-8692506 (-)

Description Similar to RPPL1: Putative disease resistance RPP13-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release
`At3g14460`	Potential disease resistance protein.	No verified direct reference in this release
`At2g28560`	May be involved in the homologous recombination repair (HRR) pathway of double-stranded DNA breaks arising during DNA replication or induced by DNA-damaging agents.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000481 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005657 replication fork Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0033063 Rad51B-Rad51C-Rad51D-XRCC2 complex Cellular Component

GO:0000150 DNA strand exchange activity Molecular Function

KEGG gene cross-reference

ath:AT2G28560

ath:AT3G14460

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.377

Rank 1 · LXL04_000481 · OH-1004

Nucleus0.324

Rank 2 · LXL04_000481 · OH-1004

Cell membrane0.281

Rank 3 · LXL04_000481 · OH-1004

Endoplasmic reticulum0.074

Rank 4 · LXL04_000481 · OH-1004

Plastid0.073

Rank 5 · LXL04_000481 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26169.1HHH_XRCC3_RpoA6-59 aa

PF08423.18Rad5186-316 aa

PF13481.13AAA_2597-219 aa

PF18052.7Rx_N393-481 aa

PF00931.29NB-ARC567-736 aa

PF23559.2WHD_DRP822-890 aa

PF23598.2LRR_14964-1317 aa

PF13855.13LRR_8973-1029 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000481	`PF26169.1`	HHH_XRCC3_RpoA	6	59	8.3e-19	67.9
LXL04_000481	`PF08423.18`	Rad51	86	316	2.4e-20	73.6
LXL04_000481	`PF13481.13`	AAA_25	97	219	2.1e-06	28.2
LXL04_000481	`PF18052.7`	Rx_N	393	481	5.8e-17	62.3
LXL04_000481	`PF00931.29`	NB-ARC	567	736	3.4e-37	128.4
LXL04_000481	`PF23559.2`	WHD_DRP	822	890	2.9e-25	88.8
LXL04_000481	`PF23598.2`	LRR_14	964	1317	3.9e-36	125.2
LXL04_000481	`PF13855.13`	LRR_8	973	1029	5.7e-09	36.3
LXL04_000481	`PF25019.1`	LRR_R13L1-DRL21	1083	1210	4.1e-48	163.2
LXL04_000481	`PF23598.2`	LRR_14	1425	1540	3.9e-36	125.2
LXL04_000481	`PF23247.2`	LRR_RPS2	1506	1547	4.6e-15	56.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR4`	Arabidopsis thaliana	Putative disease resistance RPP13-like protein 1	37.611%	Swiss-Prot	moderate database homology
`Q9LRR5`	Arabidopsis thaliana	Putative disease resistance protein At3g14460	34.783%	Swiss-Prot	moderate database homology
`Q9SK02`	Arabidopsis thaliana	DNA repair protein RAD51 homolog 2	66.102%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card